In vitro and in vivo functions of SARS-CoV-2 infection-enhancing and neutralizing antibodies

Lead contact

Further information and requests for reagents should be directed and will be fulfilled by the lead contact Kevin O. Saunders (kevin.saunders@duke.edu).

Materials availability

Abs and other reagents generated in this study are available from the lead contact with a completed Materials Transfer Agreement.

Data and code availability

The data that support the findings of this study are available from the corresponding authors on request.

Human subjects

Nasopharyngeal swabs and peripheral blood samples were collected from a convalescent COVID-19 donor (MESSI ID #450905) on designated days after reported onset of COVID symptoms. The SARS-CoV donor PBMC were provided by the NIH/VRC. Human specimens were collected and used with the informed consent of study participants and in compliance with the Duke University Medical Center Institutional Review Board (DUHS IRB Pro00100241).

Symptom data collections

Participant self-reported symptoms were recorded at each time-point for 39 symptom categories (nasal discharge, nasal congestion, sneezing, coughing, shortness of breath, malaise, throat discomfort, fever, headache, shaking chills, loss of smell, loss of taste, excessive sweating, dizziness, pain behind the eyes, itchy/watery eyes, visual blurring, hearing problems, ear pain, confusion, stiff neck, swollen glands, palpitations, chest pain, pain in joints, muscle soreness, fatigue, loss of appetite, abdominal pain, nausea/vomiting, diarrhea, swelling, itchy skin, rash, skin lesions, unusual bleeding, red fingers or toes, red eyes, other: specify). Each symptom was scored on a scale of 0–4, with 0 indicating not present, 1 mild, 2 moderate, 3 severe, and 4 very severe symptoms. Daily symptom count (number of non-zero symptom categories) and symptom severity (sum of all symptom scores) were determined for each survey time point. At enrollment, date of symptom onset was determined, and an initial “historical” symptom survey recorded maximum score for each symptom category between symptom onset and study enrollment.

Non-human primate model

In total, 62 outbred adult male and female cynomolgus macaques (Macaca fascicularis), 2-4 kg body weight, were randomly allocated to groups. The study protocol and all veterinarian procedures were approved by the Bioqual IACUC per a memorandum of understanding with the Duke IACUC, and were performed based on standard operating procedures. Macaques were housed and maintained in an Association for Assessment and Accreditation of Laboratory Animal Care-accredited institution in accordance with the principles of the National Institute of Health. All studies were carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health in BIOQUAL (Rockville, MD). BIOQUAL is fully accredited by AAALAC and through OLAW, Assurance Number A-3086. All physical procedures associated with this work were done under anesthesia to minimize pain and distress in accordance with the recommendations of the Weatherall report, “The use of non-human primates in research.” Teklad 5038 Primate Diet was provided once daily by animal size and weight. The diet was supplemented with fresh fruit and vegetables. Fresh water was given ad libitum. All monkeys were maintained in accordance with the Guide for the Care and Use of Laboratory Animals.

Mouse models

Eleven to twelve-month old female immunocompetent BALB/c mice purchased from Envigo (BALB/c AnNHsd, stock# 047) were used for SARS-CoV-2 in vivo protection experiments as described previously (Dinnon et al., 2020; Leist et al., 2020a). Ten-week-old HFH4-hACE2 transgenic mice were bred and maintained at the University of North Carolina at Chapel Hill and used for WIV-1 in vivo protection experiments. Mice were housed in groups of five animals per cage and fed standard chow diet. The study was carried out in accordance with the recommendations for care and use of animals by the Office of Laboratory Animal Welfare (OLAW), National Institutes of Health and the Institutional Animal Care. All mouse studies were performed at the University of North Carolina (Animal Welfare Assurance #A3410-01) using protocols (19-168) approved by the UNC Institutional Animal Care and Use Committee (IACUC) and all mouse studies were performed in a BSL3 facility at UNC.

Expression of recombinant viral proteins

The SARS-CoV-2 ectodomain constructs were produced and purified as described previously (Wrapp et al., 2020b). Plasmids encoding Spike-2P and HexaPro (Hsieh et al., 2020) were transiently transfected in FreeStyle 293F cells (Thermo Fisher) using Turbo293 (SpeedBiosystems). The cultures were collected on Day 6 post transfection. The cells were separated from the medium by centrifugation. Protein were purified from filtered cell supernatants by StrepTactin resin (IBA) and additionally by size exclusive chromatography using Superose 6 10/300 increase column (GE Healthcare) in 2mM Tris pH 8, 200mM NaCl, 0.02% NaN₃. SARS-CoV-2 NTD was produced as previously described (Zhou et al., 2020b). SARS-CoV RBD and MERS-CoV Spike RBD were cloned into pVRC8400 vector for mammalian expression (FreeStyle 293F or Expi293F suspension cells). The construct contains an HRV 3C-cleavable C-terminal SBP-8xHis tag. Supernatants were harvested 5 days post-transfection and passaged directly over Cobalt-TALON resin (Takara) followed by size exclusion chromatography on Superdex 200 Increase (GE Healthcare) in 1x PBS. Typical yields from FreeStyle 293F cells are approximately 50 mg/liter culture. Affinity tags can be removed using HRV 3C protease (ThermoScientific) and the protein repurified using Cobalt-TALON resin to remove the protease, tag and non-cleaved protein.

Antigen-specific single B cell sorting

Plasmablasts were sorted by flow cytometry from the SARS-CoV-2 donor on Day 11 and Day 15 post symptom onset. PBMCs were stained with optimal concentrations of the following fluorochrome-Ab conjugates: IgD PE (Clone# IA6-2, BD Biosciences, Catalog# 555779), CD3 PE-Cy5 (Clone# HIT3a, BD Biosciences, Catalog# 555341), CD10 PE-CF594 (Clone# HI10A, BD Biosciences, Catalog# 562396), CD27 PE-Cy7 (Clone# O323, eBioscience, Catalog# 25-0279), CD38 APC-Alexa Fluor (AF) 700 (Clone# LS198-4-2, Beckman Coulter, Catalog# B23489), CD19 APC-Cy7 (Clone# LJ25C1, BD Biosciences, Catalog# 561743), CD16 BV570 (Clone# 3G8, Biolegend, Catalog# 302035), CD14 BV605 (Clone# M5E2, Biolegend, Catalog# 301834), and CD20 BV650 (Clone# 2H7, BD, Catalog# 563780). The cells were then labeled with Fixable Aqua Live/Dead Cell Stain Kit (Invitrogen, Catalog# L34957). On a BD FACSAria II flow cytometer (BD Biosciences), plasmablasts were identified as viable CD14^-/CD16^-/CD19⁺/CD20^low/IgD^-/CD27^high/CD38^high cells and sorted as single cells into 96-well plates containing lysis buffer. Sorted plates were frozen at −80°C in the DHVI Flow Facility under BSL3 precautions in the Duke Regional Biocontainment Laboratory (Durham, NC) until processing.

Antigen-specific memory B cells (MBCs) were isolated by flow cytometric sorting from the SARS-CoV-2 donor on Day 36 post symptom onset, and a donor with SARS-CoV history. PBMCs were stained with IgD FITC (Clone# IA6-2, BD Biosciences, Catalog# 555778), IgM PerCp-Cy5.5 (Clone# G20-127, BD Biosciences, Catalog# 561285), CD10 PE-CF594 (Clone# HI10A, BD Biosciences, Catalog# 562396), CD3 PE-Cy5 (Clone# HIT3a, BD Biosciences, Catalog# 555341), CD235a PE-Cy5 (Clone# GA-R2, BD Biosciences, Catalog# 559944), CD27 PE-Cy7 (Clone# O323, eBioscience, Catalog# 25-0279), CD38 APC-AF700 (Clone# LS198-4-2, Beckman Coulter, Catalog# B23489), CD19 APC-Cy7 (Clone# LJ25C1, BD Biosciences, Catalog# 561743), CD14 BV605 (Clone# M5E2, Biolegend, Catalog# 301834), CD16 BV570 (Clone# 3G8, Biolegend, Catalog# 302035), and fluorescent-labeled SARS-CoV-2 Spike probes (AF647-conjugated Spike-2P, PE-conjugated Spike-2P, AF647-conjugated NTD, AF647-conjugated RBD, VioBright 515-conjugated RBD). The cells were then labeled with Fixable Aqua Live/Dead Cell Stain Kit (Invitrogen, Catalog# L34957). On a BD FACSAria II flow cytometer (BD Biosciences), antigen-specific MBCs were identified as viable CD3^-/CD14^-/CD16^-/CD235a^-/CD19⁺/IgD^-/probe⁺ cells and were sorted as single cells into 96-well plates containing lysis buffer. Collection plates were immediately frozen in a dry ice/ethanol bath, and stored at −80°C in the DHVI Flow Facility under BSL3 precautions in the Duke Regional Biocontainment Laboratory until processing. Flow cytometric data were analyzed using FlowJo version 10.

PCR Amplification of human Ab genes

Ab genes were amplified by RT-PCR from flow cytometry-sorted single B cells using the methods as described previously (Liao et al., 2009; Wrammert et al., 2008) with modification. The PCR-amplified genes were then purified and sequenced with 10 μM forward and reverse primers. Sequences were analyzed by using the human library in Cloanalyst for the VDJ arrangements of the immunoglobulin IGHV, IGKV, and IGLV sequences and mutation frequencies (Kepler et al., 2014). Clonal relatedness of V_HD_HJ_H and V_LJ_L sequences was determined as previously described (Liao et al., 2013).

Expression of Ab viable region genes as full-length IgG recombinant mAbs

Transient transfection of recombinant Abs was performed as previously described (Liao et al., 2009). Briefly, purified PCR products were used for overlapping PCR to generate linear human IgG expression cassettes. The expression cassettes were transfected into Expi293F cells using ExpiFectamine (Thermo Fisher Scientific, Catalog# A14525 and A14527). The supernatant samples containing recombinant IgGs were used for IgG quantification and preliminary ELISA binding screening.

The down-selected human Ab genes were then synthesized and cloned (GenScript) into a human IgG1 backbone (HV1301409_4A) with 4A mutations to enhance circulation half-life and Ab-dependent cell-mediated cytotoxicity (ADCC) or a human IgG1 backbone (pH510049_VRC_LS.v2) with a LS mutation to extend Ab half-life (Saunders, 2019). Recombinant IgG Abs were then produced in HEK293i suspension cells by transfection with ExpiFectamine and purified using Protein A resin. The purified IgG Abs were run in SDS-PAGE for Coomassie blue staining and western blot for quality control and then used for the downstream experiments.

Ab binding ELISA

For ELISA binding assays of coronavirus Spike Abs, the antigen panel included SARS-CoV-2 Spike S1+S2 ectodomain (ECD) (SINO, Catalog # 40589-V08B1), SARS-CoV-2 Spike-2P (Wrapp et al., 2020b), SARS-CoV-2 Spike S2 ECD (SINO, Catalog # 40590-V08B), SARS-CoV-2 Spike RBD from insect cell sf9 (SINO, Catalog # 40592-V08B), SARS-CoV-2 Spike RBD from mammalian cell 293 (SINO, Catalog # 40592- V08H), SARS-CoV-2 Spike NTD-Biotin, SARS-CoV Spike Protein DeltaTM (BEI, Catalog # NR-722), SARS-CoV WH20 Spike RBD (SINO, Catalog # 40150-V08B2), SARS-CoV WH20 Spike S1 (SINO, Catalog #40150-V08B1), SARS-CoV RBD, MERS-CoV Spike S1+S2 (SINO, Catalog # 40069-V08B), MERS-CoV Spike S1 (SINO, Catalog #40069-V08B1), MERS-CoV Spike S2 (SINO, Catalog #40070-V08B), MERS-CoV Spike RBD (SINO, Catalog #40071-V08B1), MERS-CoV Spike RBD. In preliminary ELISA screening of the transient transfection supernatants, we also screened the Abs against SARS-CoV CL Protease protein (BEI, Catalog # 30105) and SARS-CoV Membrane (M) protein (BEI, Catalog # 110705).

For binding ELISA, 384-well ELISA plates were coated with 2 μg/mL of antigens in 0.1 M sodium bicarbonate overnight at 4°C. Plates were washed with PBS + 0.05% Tween 20 and blocked with blocked with assay diluent (PBS containing 4% (w/v) whey protein, 15% Normal Goat Serum, 0.5% Tween-20, and 0.05% Sodium Azide) at room temperature for 1 hour. Purified mAb samples in 3-fold serial dilutions in assay diluent starting at 100 μg/mL, or un-diluted transfection supernatant were added and incubated for 1 hour, followed by washing with PBS-0.1% Tween 20. HRP-conjugated goat anti-human IgG secondary Ab (SouthernBiotech, catalog# 2040-05) was diluted to 1:10,000 and incubated at room temperature for 1 hour. These plates were washed four times and developed with tetramethylbenzidine substrate (SureBlue Reserve- KPL). The reaction was stopped with 1 M HCl, and optical density at 450 nm (OD₄₅₀) was determined.

Affinity measurements

SPR measurements of SARS-CoV-2 Ab Fab binding to Spike-2P or Spike-HexaPro proteins were performed using a Biacore S200 instrument (Cytiva, formerly GE Healthcare, DHVI BIA Core Facility, Durham, NC) in HBS-EP+ 1x running buffer. The Spike proteins were first captured onto a Series S Streptavidin chip to a level of 300-400 RU for Spike-2P and 350-450 resonance units (RU) for Spike-HexaPro. The Ab Fabs were injected at 0.5 to 500 nM over the captured S proteins using the single cycle kinetics injection mode at a flow rate of 50uL/min. Association phase was maintained with either 120 or 240 s injections of each Fab at increasing concentrations followed by a dissociation of 600 s after the final injection. After dissociation, the S proteins were regenerated from the streptavidin surface using a 30 s pulse of Glycine pH1.5. Results were analyzed using the Biacore S200 Evaluation software (Cytiva). A blank streptavidin surface along with blank buffer binding were used for double reference subtraction to account for non-specific protein binding and signal drift. Subsequent curve fitting analyses were performed using a 1:1 Langmuir model with a local Rmax for the Fabs with the exception of DH1050.1 Fab which was fit using the heterogeneous ligand model with local Rmax. The reported binding curves are representative of two datasets.

Surface plasmon resonance Ab blocking assay

RBD and NTD Abs binding to S protein was measured by surface plasmon resonance (BIAcore 3000; Cytiva, formerly GE Healthcare, DHVI BIA Core Facility, Durham, NC) analysis. Ab binding competition and blocking were measured by SPR following immobilization by amine coupling of monoclonal Abs to CM5 sensor chips (BIAcore/Cytiva). Ab competition experiments were performed by mixing S protein and mAb (30 minutes incubation) followed by injection for 5 minutes at 50 μL/min. In separate assays and from analysis of binding to an identical epitope binding ligand, it was determined that S protein at 20 μm and Ab at 200 μm bind to complete saturation. Ab blocking assays were performed by co-injecting S protein (20 μM) over mAb immobilized surfaces for 3 minutes at 30 μL/min and a test Ab (200 μM) for 3 minutes at 30 μL/min. The dissociation of the Ab sandwich complex with the spike protein was monitored for 10 minutes with buffer flow and then a 24 s injection of Glycine pH2.0 for regeneration. Blank buffer binding was used for subtraction to account for signal drift. Data analyses were performed with BIA-evaluation 4.1 software (BIAcore/Cytiva).

ACE2-blocking assay

For ACE-2 blocking assays, plates were coated as stated above with 2 μg/mL recombinant ACE-2 protein, then washed and blocked with 3% BSA in 1X PBS. While assay plates blocked, purified Abs were diluted as stated above, only in 1% BSA with 0.05% Tween-20. In a separate dilution plate Spike-2P protein was mixed with the Abs at a final concentration equal to the EC₅₀ at which spike binds to ACE-2 protein. The mixture was allowed to incubate at room temperature for 1 hour. Blocked assay plates were then washed and the Ab-spike mixture was added to the assay plates for a period of 1 hour at room temperature. Plates were washed and a polyclonal rabbit serum against the same Spike-2P protein was added for 1 hour, washed and detected with goat anti rabbit-HRP (Abcam cat# ab97080) followed by TMB substrate. The extent to which Abs were able to block the binding of spike protein to ACE-2 was determined by comparing the optical density (OD) at 450 nm of Ab plus spike to the OD of wells containing spike protein without Ab. The following formula was used to calculate percent blocking: blocking% = (100 - (OD Ab+spike /OD of spike only)^∗100).

Negative-stain electron microscopy

Fab fragments were prepared by digesting the IgG with Lys-C, as described previously (Zhou et al., 2015). For each Fab-spike complex, an aliquot of spike protein at ∼1-5 mg/ml concentration that had been flash frozen and stored at −80°C was thawed in an aluminum block at 37°C for 5 minutes; then 1-4 μl of spike was mixed with sufficient Fab to give a 9:1 molar ratio of Fab to spike and incubated for 1 hour at 37°C. The complex was then cross-linked by diluting to a final spike concentration of 0.1 mg/ml into room-temperature buffer containing 150 mM NaCl, 20 mM HEPES pH 7.4, 5% glycerol, and 7.5 mM glutaraldehyde. After 5 minutes cross-linking, excess glutaraldehyde was quenched by adding sufficient 1 M Tris pH 7.4 stock to give a final concentration of 75 mM Tris and incubated for 5 minutes. For negative stain, carbon-coated grids (EMS, CF300-cu-UL) were glow-discharged for 20 s at 15 mA, after which a 5-μl drop of quenched sample was incubated on the grid for 10-15 s, blotted, and then stained with 2% uranyl formate. After air drying, grids were imaged with a Philips EM420 electron microscope operated at 120 kV, at 82,000x magnification and images captured with a 2k x 2k CCD camera at a pixel size of 4.02 Å.

Image processing of negative stain images

The RELION 3.0 program was used for all negative stain image processing. Images were imported, CTF-corrected with CTFFIND, and particles were picked using a spike template from previous 2D class averages of spike alone. Extracted particle stacks were subjected to 2-3 rounds of 2D class averaging and selection to discard junk particles and background picks. Cleaned particle stacks were then subjected to 3D classification using a starting model created from a bare spike model, PDB: 6vsb, low-pass filtered to 30 Å. Classes that showed clearly-defined Fabs were selected for final refinements followed by automatic filtering and B-factor sharpening with the default Relion post-processing parameters.

Cryo-EM sample preparation, data collection and processing

To prepare Ab-bound complexes of the SARS-CoV-2 2P spike, the spike at a final concentration of 1–2 mg/mL, in a buffer containing 2 mM Tris pH 8.0, 200 mM NaCl and 0.02% NaN3, was incubated with 5-6 fold molar excess of the Ab Fab fragments for 30–60 min. 0.5% final concentration of glycerol was added to the sample right before freezing. 2.5 μL of protein was deposited on a Quantifoil-1.2/1.3 holey carbon grid that had been glow discharged in a PELCO easiGlow Glow Discharge Cleaning System for 15 s at 15 mA. After a 30 s incubation in > 95% humidity and 22°C, excess protein was blotted away for 2.5 s using a Whatman #1 filter paper before being plunge frozen into liquid ethane using a Leica EM GP2 plunge freezer (Leica Microsystems). Cryo-EM data were collected on a Titan Krios (Thermo Fisher) equipped with a K3 detector (Gatan). Data were acquired using the Leginon system (Suloway et al., 2005). All the datasets were energy filtered through either a 20eV or 30eV slit. The dose was fractionated over 50 raw frames and collected at 50ms framerate. Individual frames were aligned and dose-weighted (Zheng et al., 2017). CTF estimation, particle picking and all downstream data processing steps were carried out in cryoSparc (Punjani et al., 2017). After two rounds of 2D classifications during which junk particles were discarded, heterogeneous refinement was performed using low pass filtered maps of unliganded spike as inputs. The output maps showed densities of the bound Fabs, which were further classified by heterogeneous refinement, followed by non-uniform refinement to obtain the final reconstructions that were used for model fitting.

Cryo-EM structure fitting and analysis

Previously published SARS-CoV-2 ectodomain structures of the all ‘down’ state (PDB: 6VXX) and single RBD ‘up’ state (PDB: 6VYB), and models of 2-RBD-up and 3-RBD-up states derived from these, were used to fit the cryo-EM maps in Chimera (Pettersen et al., 2004). Models of Fabs were generated in SWIS-MODEL and docked into the cryo-EM reconstructions using Chimera. Mutations were made in Coot (Emsley and Cowtan, 2004). Coordinates were fit to the maps using ISOLDE (Croll, 2018) followed by iterative refinement using Phenix (Afonine et al., 2018) real space refinement and subsequent manual coordinate fitting in Coot as needed. Structure and map analysis were performed using PyMol (Schrö and dinger, 2015), Chimera (Pettersen et al., 2004) and ChimeraX (Goddard et al., 2018).

Live SARS-CoV-2 neutralization assays

The SARS-CoV-2 virus (Isolate USA-WA1/2020, NR-52281) was deposited by the Centers for Disease Control and Prevention and obtained through BEI Resources, NIAID, NIH. SARS-CoV-2 Micro-neutralization (MN) assays were adapted from a previous study (Berry et al., 2004). In short, sera or purified Abs were diluted two-fold and incubated with 100 TCID50 virus for 1 hour. These dilutions are used as the input material for a TCID50. Each batch of MN includes a known neutralizing control Ab (Clone D001; SINO, CAT# 40150-D001). Data are reported as the last concentration at which a test sample protects Vero E6 cells.

SARS-CoV-2 Plaque Reduction Neutralization Test (PRNT) were performed in the Duke Regional Biocontainment Laboratory BSL3 (Durham, NC) as previously described with virus-specific modifications (Berry et al., 2004). Briefly, two-fold dilutions of a test sample (e.g., serum, plasma, purified Ab) were incubated with 50 PFU SARS-CoV-2 virus (Isolate USA-WA1/2020, NR-52281) for 1 hour. The Ab/virus mixture is used to inoculate Vero E6 cells in a standard plaque assay (Coleman and Frieman, 2015; Kint et al., 2015). Briefly, infected cultures are incubated at 37°C, 5% CO2 for 1 hour. At the end of the incubation, 1 mL of a viscous overlay (1:1 2X DMEM and 1.2% methylcellulose) is added to each well. Plates are incubated for 4 days. After fixation, staining and washing, plates are dried and plaques from each dilution of each sample are counted. Data are reported as the concentration at which 50% of input virus is neutralized. A known neutralizing control Ab is included in each batch run (Clone D001; SINO, CAT# 40150-D001). GraphPad Prism was used to determine IC/EC₅₀ values.

SARS-CoV-2 nano-luciferase (nanoLuc), SARS-CoV nanoLuc and WIV1-CoV nanoLuc replication-competent virus neutralization assay were described previously (Hou et al., 2020; Menachery et al., 2016; Sheahan et al., 2017).

Pseudo-typed SARS-CoV-2 neutralization assay and infection-enhancing assays

Neutralization of SARS-CoV-2 Spike-pseudotyped virus was performed by adopting an infection assay described previously (Korber et al., 2020) with lentiviral vectors and infection in either 293T/ACE2.MF (the cell line was kindly provided by Drs. Mike Farzan and Huihui Mu at Scripps). Cells were maintained in DMEM containing 10% FBS and 50 μg/ml gentamicin. An expression plasmid encoding codon-optimized full-length spike of the Wuhan-1 strain (VRC7480), was provided by Drs. Barney Graham and Kizzmekia Corbett at the Vaccine Research Center, National Institutes of Health (USA). The D614G mutation was introduced into VRC7480 by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit from Agilent Technologies (Catalog # 210518). The mutation was confirmed by full-length spike gene sequencing. Pseudovirions were produced in HEK293T/17 cells (ATCC cat. no. CRL-11268) by transfection using Fugene 6 (Promega, Catalog #E2692). Pseudovirions for 293T/ACE2 infection were produced by co-transfection with a lentiviral backbone (pCMV ΔR8.2) and firefly luciferase reporter gene (pHR’ CMV Luc) (Naldini et al., 1996). Culture supernatants from transfections were clarified of cells by low-speed centrifugation and filtration (0.45 μm filter) and stored in 1 mL aliquots at −80°C.

For 293T/ACE2 neutralization assays, a pre-titrated dose of virus was incubated with 8 serial 3-fold or 5-fold dilutions of mAbs in duplicate in a total volume of 150 μl for 1 hr at 37°C in 96-well flat-bottom poly-L-lysine-coated culture plates (Corning Biocoat). Cells were suspended using TrypLE express enzyme solution (Thermo Fisher Scientific) and immediately added to all wells (10,000 cells in 100 μL of growth medium per well). One set of 8 control wells received cells + virus (virus control) and another set of 8 wells received cells only (background control). After 66-72 hr of incubation, medium was removed by gentle aspiration and 30 μL of Promega 1x lysis buffer was added to all wells. After a 10-minute incubation at room temperature, 100 μl of Bright-Glo luciferase reagent was added to all wells. After 1-2 minutes, 110 μl of the cell lysate was transferred to a black/white plate (Perkin-Elmer). Luminescence was measured using a PerkinElmer Life Sciences, Model Victor2 luminometer. Neutralization titers are the mAb concentration (IC₅₀/IC80) at which relative luminescence units (RLU) were reduced by 50% and 80% compared to virus control wells after subtraction of background RLUs. Negative neutralization values are indicative of infection-enhancement. Maximum percent inhibition (MPI) is the reduction in RLU at the highest mAb concentration tested.

For the TZM-bl neutralization assays, a pre-titrated dose of virus was incubated with serial 3-fold dilutions of test sample in duplicate in a total volume of 150 ul for 1 hr at 37°C in 96-well flat-bottom culture plates. Freshly trypsinized cells (10,000 cells in 100 μL of growth medium containing 75 μg/ml DEAE dextran) were added to each well. One set of control wells received cells + virus (virus control) and another set received cells only (background control). After 68-72 hours of incubation, 150 μL of cultured medium was removed from each well, and 100ul of Britelite Luminescence Reporter Gene Assay System (PerkinElmer Life Sciences) were added and plates incubated for 2 min at room temperature. After this period 150 μL of the lysate was transferred to black solid plates (Costar) for measurements of luminescence in a Perking Elmer instrument. Neutralization titers are the serum dilution at which relative luminescence units (RLU) were reduced by 50% and 80% compared to virus control wells after subtraction of background RLUs. MPI is the reduction in RLU at the highest mAb concentration tested. Infection-enhancing assays were performed with the same format but using TZM-bl cell lines stably expressing each of the four human FcγR receptors (Perez et al., 2009). In this assay an increase in RLUs over the virus control signal represents FcR-mediated entry.

Non-human primate protection study

Groups of five cynomolgus macaques (2-4 kg) were given intravenous infusion with Abs at 10 mg/kg body weight on Day −3, relative to infectious virus challenge. For each animal, 10⁵ PFU (∼10⁶ TCID50) SARS-CoV-2 virus (Isolate USA-WA1/2020) were diluted in 4 mL, and were given by 1 mL intranasally and 3 mL intratracheally on Day 0. Plasma and serum samples were collected on Day −5, 0, 2, and 4. Nasal swabs, nasal washes, and bronchoalveolar lavage (BAL) were collected on Day −5, 2, and 4.

Histopathology and Immunohistochemistry (IHC)

Lung specimen from nonhuman primates were fixed in 10% neutral buffered formalin, processed, and blocked in paraffin for histological analysis. All samples were sectioned at 5 μm and stained with hematoxylin-eosin (H&E) for routine histopathology. Sections were examined under light microscopy using an Olympus BX51 microscope and photographs were taken using an Olympus DP73 camera.

Staining for SARS-CoV-2 antigen was achieved on the Bond RX automated system with the Polymer Define Detection System (Leica) used per manufacturer’s protocol. Tissue sections were dewaxed with Bond Dewaxing Solution (Leica) at 72°C for 30 min then subsequently rehydrated with graded alcohol washes and 1x Immuno Wash (StatLab). Heat-induced epitope retrieval (HIER) was performed using Epitope Retrieval Solution 1 (Leica), heated to 100^oC for 20 minutes. A peroxide block (Leica) was applied for 5 min to quench endogenous peroxidase activity prior to applying the SARS-CoV-2 Ab (1:2000, GeneTex, GTX135357). Abs were diluted in Background Reducing Ab Diluent (Agilent). The tissue was subsequently incubated with an anti-rabbit HRP polymer (Leica) and colorized with 3,3′-Diaminobenzidine (DAB) chromogen for 10 min. Slides were counterstained with hematoxylin. For macrophage staining, Abs for the following markers were used: CD3 (T cell marker; Bio Rad, Catalog # MCA1477; 1:600 dilution), Iba1 (macrophage marker; Wako, Catalog # 019-19741; 1:800 dilution), CD68 (M1 macrophage marker, Sigma-Millipore, Catalog # HPA048982; 1:1000 dilution), CD163 (M2 macrophage marker; Abcam, Catalog # ab182422; 1:500 dilution), HLA-DP/DQ/DR (Catalog # M1 macrophage marker; Dako, Catalog # M0775; 1:100 dilution), CD11b (monocyte/granulocyte marker; Abcam, Catalog # ab52478; 1:1000 dilution).

Samples were evaluated by a board-certified veterinary pathologist in a blinded manner. Sections of the left caudal (Lc), right middle (Rm), and right caudal (Rc) lung were evaluated and scored for the presence of inflammation by H&E staining, and for the presence of SARS-CoV-2 nucleocapsid by IHC staining. The sums of Lc, Rm, and Rc scores in each animal shown in figures.

Luminex assay

For cytokine profiling, 7-fold concentrated cynomolgus macaques BAL samples were measured using a 25-analyte multiplex bead array (Millipore, catalog # PRCYT2MAG40K) including sCD137, Eotaxin, sFasL, FGF-2, Fractalkine, Granzyme A, Granzyme B, IL-1α, IL-2, IL-4, IL-6, IL-16, IL-17A, IL-17E/IL-25, IL-21, IL-22, IL-23, IL-28A, IL-31, IL-33, IP-10, MIP-3α, Perforin, RANTES, TNFβ. Samples were prepared according to the manufacturer’s recommended protocol and read using a Flexmap 3D suspension array reader (Luminex Corp.). Data were analyzed using Bio-Plex manager software v6.2 (Bio-Rad).

For human Ab quantification, SARS-CoV-2 Spike-2P protein, A/Solomon Islands/3/2006 hemagglutinin (HA) protein or bovine serum albumen (Sigma) was carbodiimide coupled to MagPlex-C beads (Luminex Corp) according to the bead manufacturer’s protocol. Briefly, beads were washed in H₂O then activated by incubation with 5 mg/mL sulfo-N-hydroxysulfosuccinimide and 5 mg/mL 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (ThermoFisher) for 20 minutes. Activated beads were washed twice in PBS (ThermoFisher) and then vortexed at 1,500 RPM for two hours at room temperature with 25 μg protein per 5.0 × 10⁶ beads. Labeled beads were washed in PBS (ThermoFisher), 1% BSA, 0.02% Tween-20, 0.05% Sodium Azide (all Sigma), counted using a hemacytometer and stored at −80°C. NHP sera were diluted 1:200 in assay buffer (PBS, 1% BSA, pH 7.4, GIBCO), then 50 μL of diluted sera or monoclonal Ab 3-fold serially diluted in assay buffer (1000-0.45ng/mL) was added to a 96-well plate and mixed with 50 μL of assay buffer containing 2500 BSA-conjugated beads (negative control) plus 2500 HA or Spike-conjugated beads. The plate was shaken at 800 RPM for 60 minutes at room temperature, washed twice in assay buffer and then 100 μL 4 μg/mL biotin-conjugated mouse anti-human IgG Fc clone H2 (Southern Biotech) in assay buffer was added to every well. The plate was shaken at 800 RPM for 30 minutes at room temperature, washed two times in assay buffer and then 50 μL 4 μg/mL streptavidin-r-phycoerythrin (Invitrogen) in assay buffer was added to every well. The plate was shaken at 800 RPM for 30 minutes at room temperature and washed twice in assay buffer. Beads were resuspended in 150 μL/well assay buffer, shaken at 800 RPM for 15 minutes at room temperature and then analyzed on a BioPlex 200 bead reader (Bio-Rad). Sera antigen-specific Ab concentrations were calculated using Bio-Plex Manager software (Bio-Rad) by extrapolating from the results of the serially-diluted monoclonal Ab. Sera with Abs above the upper limit of quantitation were re-assayed at 1:1000 or 1:5000. The limit of detection (LOD) for this assay is 0.278 μg/mL.

Mouse protection study

Eleven to twelve-month old female immunocompetent BALB/c mice purchased from Envigo (BALB/c AnNHsd, stock# 047) were used for SARS-CoV-2 in vivo protection experiments as described previously (Dinnon et al., 2020). Ten-week-old HFH4-hACE2 transgenic mice were bred and maintained at the University of North Carolina at Chapel Hill and used for WIV-1 in vivo protection experiments. Mice were housed in groups of five animals per cage and fed standard chow diet. Virus inoculations were performed under anesthesia (Ketamine and Xylazine) and effort was taken to minimize animal suffering. For evaluating the prophylactic efficacy of mAbs, mice were intraperitoneally treated with 300 μg of each mAb or 150 μg of each mAb in combination 12 hours prior to infection. Mice were infected intranasally with 10⁵ PFU of mouse-adapted SARS-CoV-2 2AA MA (Dinnon et al., 2020) or WIV-1. For evaluating the therapeutic efficacy of mAbs, mice were intraperitoneally treated with 300 μg of each mAb or 150 μg of each mAb in combination 12 hours following infection. Forty-eight hours post infection, mice were sacrificed, and lungs were harvested for viral titer as measured by plaque assays and RNA analysis. In another study, fifty-two weeks old female BALB/c mice were i.p. injected with DH1052 (200 μg/mice, n = 10) or CH65 control Ab (200 μg/mice, n = 9). After 12 hours, mice were challenged with 10⁴ PFU of mouse-adapted SARS-CoV-2 MA10 virus (Leist et al., 2020a). Mice were sacrificed at day 4 post infection, and lungs were harvested for viral titer as measured by plaque assays and RNA analysis. The study was carried out in accordance with the recommendations for care and use of animals by the Office of Laboratory Animal Welfare (OLAW), National Institutes of Health and the Institutional Animal Care. All mouse studies were performed at the University of North Carolina (Animal Welfare Assurance #A3410-01) using protocols (19-168) approved by the UNC Institutional Animal Care and Use Committee (IACUC) and all mouse studies were performed in a BSL3 facility at UNC.

Viral RNA extraction and quantification

The assay for SARS-CoV-2 quantitative Polymerase Chain Reaction (qPCR) detects total RNA using the WHO primer/probe set E_Sarbeco (Charité/Berlin). A QIAsymphony SP (QIAGEN, Hilden, Germany) automated sample preparation platform along with a virus/pathogen DSP midi kit and the complex800 protocol were used to extract viral RNA from 800 μL of pooled samples. A reverse primer specific to the envelope gene of SARS-CoV-2 (5′-ATA TTG CAG CAG TAC GCA CAC A-3′) was annealed to the extracted RNA and then reverse transcribed into cDNA using SuperScript™ III Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA) along with RNase Out (Thermo Fisher Scientific, Waltham, MA). The resulting cDNA was treated with RNase H (Thermo Fisher Scientific, Waltham, MA) and then added to a custom 4x TaqMan™ Gene Expression Master Mix (Thermo Fisher Scientific, Waltham, MA) containing primers and a fluorescently labeled hydrolysis probe specific for the envelope gene of SARS-CoV-2 (forward primer 5′-ACA GGT ACG TTA ATA GTT AAT AGC GT-3′, reverse primer 5′-ATA TTG CAG CAG TAC GCA CAC A-3′, probe 5′-6FAM/AC ACT AGC C/ZENA TCC TTA CTG CGC TTC G/IABkFQ-3′). The qPCR was carried out on a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA) using the following thermal cycler parameters: heat to 50°C, hold for 2 min, heat to 95°C, hold for 10 min, then the following parameters are repeated for 50 cycles: heat to 95°C, hold for 15 s, cool to 60°C and hold for 1 minute. SARS-CoV-2 RNA copies per reaction were interpolated using quantification cycle data and a serial dilution of a highly characterized custom DNA plasmid containing the SARS-CoV-2 envelope gene sequence. Mean RNA copies per milliliter were then calculated by applying the assay dilution factor (DF = 11.7). The limit of detection (LOD) for this assay is approximately 62 RNA copies per milliliter of sample.

Subgenomic mRNA assay

SARS-CoV-2 E gene and N gene subgenomic mRNA (sgRNA) was measured by a one-step RT-qPCR adapted from previously described methods (Wölfel et al., 2020; Yu et al., 2020). To generate standard curves, a SARS-CoV-2 E gene sgRNA sequence, including the 5′UTR leader sequence, transcriptional regulatory sequence (TRS), and the first 228 bp of E gene, was cloned into a pcDNA3.1 plasmid. For generating SARS-CoV-2 N gene sgRNA, the E gene was replaced with the first 227 bp of N gene. The respectively pcDNA3.1 plasmids were linearized, transcribed using MEGAscript T7 Transcription Kit (ThermoFisher, Catalog # AM1334), and purified with MEGAclear Transcription Clean-Up Kit (ThermoFisher, Catalog # AM1908). The purified RNA products were quantified on Nanodrop, serial diluted, and aliquoted as E sgRNA or N sgRNA standards.

RNA extracted from animal samples or standards were then measured in Taqman custom gene expression assays (ThermoFisher Scientific). For these assays we used TaqMan Fast Virus 1-Step Master Mix (ThermoFisher, catalog # 4444432) and custom primers/probes targeting the E gene sgRNA (forward primer: 5′ CGATCTCTTGTAGATCTGTTCTCE 3′; reverse primer: 5′ ATATTGCAGCAGT ACGCACACA 3′; probe: 5′ FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 3′) or the N gene sgRNA (forward primer: 5′ CGATCTCTTGTAGATCTGTTCTC 3′; reverse primer: 5′ GGTGAA CCAAGACGCAGTAT 3′; probe: 5′ FAM-TAACCAGAATGGAGAACGCAGTG GG-BHQ1 3′). RT-qPCR reactions were carried out on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) or a StepOnePlus Real-Time PCR System (Applied Biosystems) using the program below: reverse transcription at 50°C for 5 minutes, initial denaturation at 95°C for 20 s, then 40 cycles of denaturation-annealing-extension at 95°C for 15 s and 60°C for 30 s. Standard curves were used to calculate E or N sgRNA in copies per ml; the limit of detections (LOD) for both E and N sgRNA assays were 12.5 copies per reaction or 150 copies per mL of BAL/nasal swab fluid.